EnhancerDB
  1. Home
  2. TFBS
  3. SMAD2[chr16:85623396-85623409]
Chromosome characteristics of SMAD2[chr16:85623396-85623409]
Back to top
Enhancers possibly regulated by SMAD2[chr16:85623396-85623409]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85541745 85623813 enh16872
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on SMAD2[chr16:85623396-85623409]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85623402 rs538166049 T G 4625880
chr16 85623408 rs375014525 GTGTGTGAATGTGAGTGTGAATA G 4625881
chr16 85623408 rs568759231 GTGTGTGAATGTGAGTGTGAATA G 4625882
Genes possibly regulated by SMAD2[chr16:85623396-85623409]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SMAD2[chr16:85623396-85623409]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results