EnhancerDB
  1. Home
  2. TFBS
  3. IRF1[chr12:50983753-50983774]
Chromosome characteristics of IRF1[chr12:50983753-50983774]
Back to top
Enhancers possibly regulated by IRF1[chr12:50983753-50983774]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 50971777 51003055 enh2348
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Ovary Bone (Osteoblast) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Muscle (A673) Heart
SNP sites on IRF1[chr12:50983753-50983774]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 50983765 rs200377185 G GTT 2627585
chr12 50983767 rs138570603 T TTCTC 2627586
chr12 50983767 rs754409676 T TTCTC 2627587
chr12 50983771 rs529750710 C CTCTCTCTCTCACTTTCTCTG 2627588
Genes possibly regulated by IRF1[chr12:50983753-50983774]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by IRF1[chr12:50983753-50983774]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results