Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 50983767 rs138570603 T TTCTC 2627586
chr12 50983767 rs754409676 T TTCTC 2627587
chr12 50983771 rs529750710 C CTCTCTCTCTCACTTTCTCTG 2627588
chr12 50983782 rs564743365 T A 2627589
chr12 50983784 rs533215581 T C 2627590

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results