EnhancerDB
  1. Home
  2. TFBS
  3. ESR2[chr16:89405863-89405878]
Chromosome characteristics of ESR2[chr16:89405863-89405878]
Back to top
Enhancers possibly regulated by ESR2[chr16:89405863-89405878]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89371847 89409975 enh16905
Bone Marrow (K562) Liver Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ESR2[chr16:89405863-89405878]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89405863 rs144590400 GAGCCCATCCTGCCCTGAGTGCACGC G 4675160
chr16 89405863 rs370053471 GAGCCCATCCTGCCCTGAGTGCACGC G 4675161
chr16 89405867 rs533757865 C G 4675162
Genes possibly regulated by ESR2[chr16:89405863-89405878]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR2[chr16:89405863-89405878]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results