| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 106128364 | 106144875 | enh29949 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 106138833 | rs367964835 | A | AATAATTATATATTATATATTTACTTTATTATATAATAT | 2873240 | |
| chr12 | 106138833 | rs71072631 | A | AATAATTATATATTATATATTTACTTTATTATATAATAT | 2873241 | |
| chr12 | 106138844 | rs529929716 | ATTATATAT | A | 2873242 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|