EnhancerDB
  1. Home
  2. TFBS
  3. SOX8[chr12:109899773-109899789]
Chromosome characteristics of SOX8[chr12:109899773-109899789]
Back to top
Enhancers possibly regulated by SOX8[chr12:109899773-109899789]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 109894065 109906915 enh14983
Liver (HepG2) Large Intestine Astrocyte Lung Stomach Muscle (A673) Placenta Uterus Pancreas Neural Stem Cells (H9) Heart
SNP sites on SOX8[chr12:109899773-109899789]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 109899776 rs66490142 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892669
chr12 109899776 rs71443859 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892670
Genes possibly regulated by SOX8[chr12:109899773-109899789]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX8[chr12:109899773-109899789]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results