Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 109894065 109906915 enh14983

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 109899776 rs66490142 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892669
chr12 109899776 rs71443859 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892670

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results