Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 116729545 116743955 enh51417

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 116742599 rs145864064 GCTCCAGGCACGTAAGACCC G 2925611
chr12 116742599 rs367941067 GCTCCAGGCACGTAAGACCC G 2925612

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results