Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 93307165 93326483 enh50546

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 93324637 rs561213145 A AATACAGCAACTGCTGTATTT 1577987

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results