Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 73719482 rs11270978 T TGTCCAGCCCAGGCACTGTGCC 9891847
chr7 73719482 rs138116401 T TGTCCAGCCCAGGCACTGTGCC 9891848

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results