| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr7 | 77311439 | 77319275 | enh9873 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr7 | 77318769 | rs149943600 | A | ACAAAGCCTAAAATATTTACAAATATTTTAGGTCTG | 9904609 | |
| chr7 | 77318769 | rs60485106 | A | ACAAAGCCTAAAATATTTACAAATATTTTAGGTCTG | 9904610 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|