EnhancerDB
  1. Home
  2. TFBS
  3. H4TF2[chr7:97911016-97911020]
Chromosome characteristics of H4TF2[chr7:97911016-97911020]
Back to top
Enhancers possibly regulated by H4TF2[chr7:97911016-97911020]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 97901885 97919594 enh24354
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Bone (Osteoblast) Stomach Placenta Colon (HCT116) Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Pancreas Pancreas (Panc1) Uterus Heart
SNP sites on H4TF2[chr7:97911016-97911020]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 97911019 rs562067767 TCCGCCGCGTCCCCGCCGCCG T 9972706
chr7 97911020 rs192143197 C T 9972707
Genes possibly regulated by H4TF2[chr7:97911016-97911020]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by H4TF2[chr7:97911016-97911020]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results