Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 104650325 104670655 enh9966

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 104655504 rs58640632 TTTGTGGGAGAGCGAGACAGCTA T 10000659

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr7 104654626 104754808 + KMT2E ENSG00000005483.15 104654626 0.78 0.99 876 7734


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results