EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr1:10866026-10868298]
Chromosome characteristics of TCF7L2[chr1:10866026-10868298]
Back to top
Enhancers possibly regulated by TCF7L2[chr1:10866026-10868298]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 10861385 10867002 enh58078
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Stomach Uterus Epithelial (MCF-7)
chr1 10868185 10900755 enh26532
Prostate (RWPE1) Esophagus Astrocyte Stomach Muscle (A673) Colon (HCT116) Pancreas Uterus Heart
SNP sites on TCF7L2[chr1:10866026-10868298]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 10866030 rs7535587 A T 75357
chr1 10866119 rs554786302 C T 75358
chr1 10866146 rs115402807 C A,T 75359
chr1 10866147 rs115695884 G A 75360
chr1 10866238 rs187562503 A G 75361
chr1 10866424 rs113158818 C CA,CAA 75362
chr1 10866426 rs561129185 A G 75363
chr1 10866480 rs80154717 G T 75364
chr1 10866495 rs543999309 G A 75365
chr1 10866626 rs116584436 G A 75366
chr1 10866805 rs142499571 C T 75367
chr1 10867024 rs74715702 A G 75368
chr1 10867032 rs4384242 A G 75369
chr1 10867074 rs10489424 C T 75370
chr1 10867100 rs147922744 A AC 75371
chr1 10867127 rs114739859 G A 75372
chr1 10867183 rs367749864 TTTCATCCATCCACCCGCCAA T 75373
chr1 10867183 rs373768161 TTTCATCCATCCACCCGCCAA T 75374
chr1 10867199 rs548603523 G A 75375
chr1 10867359 rs568902283 TCCTTCCATCCATCCAC T 75376
chr1 10867375 rs12404443 C T 75377
chr1 10867376 rs534596520 C G 75378
chr1 10867390 rs3915940 A C 75379
chr1 10867504 rs1750859 A T 75380
chr1 10867625 rs79389995 A G 75381
chr1 10867634 rs147624658 G A 75382
chr1 10867778 rs1776226 T A,G 75383
chr1 10867821 rs1750860 G A 75384
chr1 10867849 rs145450255 C T 75385
chr1 10868000 rs1557179 C A 75386
chr1 10868162 rs3860314 G A 75387
chr1 10868164 rs75718454 C T 75388
chr1 10868169 rs150263600 C T 75389
chr1 10868193 rs74389698 G T 75390
chr1 10868194 rs557375715 T C 75391
chr1 10868219 rs145854125 G A 75392
Genes possibly regulated by TCF7L2[chr1:10866026-10868298]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr1:10866026-10868298]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results