EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:110430213-110431031]
Chromosome characteristics of ZNF274[chr1:110430213-110431031]
Back to top
Enhancers possibly regulated by ZNF274[chr1:110430213-110431031]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110412890 110446635 enh12129
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Adrenal Pancreas Uterus Blood (T-cell) Stomach Ovary Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr1:110430213-110431031]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110430213 rs422197 G T 549323
chr1 110430277 rs540645568 T C 549324
chr1 110430379 rs149808851 G A 549325
chr1 110430571 rs80315857 C T 549326
chr1 110430613 rs529063871 G T 549327
chr1 110430650 rs34119694 G A 549328
chr1 110430656 rs77573287 C T 549329
chr1 110430710 rs202015065 A G 549330
chr1 110430771 rs11271144 TAGGCAGGGCGTCGGGACCCTGGTA T 549331
chr1 110430771 rs374842403 TAGGCAGGGCGTCGGGACCCTGGTA T 549332
chr1 110430899 rs375807329 G A 549333
chr1 110430929 rs418976 G C 549334
chr1 110430955 rs192504243 C G 549335
chr1 110431020 rs426597 T A 549336
Genes possibly regulated by ZNF274[chr1:110430213-110431031]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:110430213-110431031]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results