EnhancerDB
  1. Home
  2. TFBS
  3. TEF1[chr1:178912587-178913216]
Chromosome characteristics of TEF1[chr1:178912587-178913216]
Back to top
Enhancers possibly regulated by TEF1[chr1:178912587-178913216]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 178892945 178926835 enh769
Epithelial (MCF-7) Large Intestine Ovary Esophagus Astrocyte Bone (Osteoblast) Lung Stomach Placenta Uterus Blood (Karpas-422) Muscle (Myoblast) Pancreas Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on TEF1[chr1:178912587-178913216]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 178912600 rs116692299 G A 757407
chr1 178912613 rs16853494 G C 757408
chr1 178912640 rs11583587 G A 757409
chr1 178912837 rs551179698 G C 757410
chr1 178912863 rs145731548 T C 757411
chr1 178912970 rs185529500 G A 757412
chr1 178912971 rs190458567 C T 757413
chr1 178912973 rs537664079 C CATATTCTTTTGTGTATATGG 757414
chr1 178913008 rs150795902 AAGAG A 757415
chr1 178913008 rs369586197 AAGAG A 757416
chr1 178913162 rs558471345 G A 757417
chr1 178913185 rs11355345 TA T 757418
chr1 178913185 rs398049803 TA T 757419
Genes possibly regulated by TEF1[chr1:178912587-178913216]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TEF1[chr1:178912587-178913216]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results