EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:200259334-200259954]
Chromosome characteristics of ZNF274[chr1:200259334-200259954]
Back to top
Enhancers possibly regulated by ZNF274[chr1:200259334-200259954]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 200249825 200279179 enh867
Prostate (PC-3) Liver (HepG2) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Pancreas Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on ZNF274[chr1:200259334-200259954]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 200259458 rs542789275 G A 846072
chr1 200259479 rs200157689 A G 846073
chr1 200259607 rs7515411 G A 846074
chr1 200259739 rs558780801 G GTCTAGAATCATGTGCCATGATTAT 846075
chr1 200259764 rs181963874 A T 846076
chr1 200259883 rs556041879 C T 846077
chr1 200259938 rs34959467 T C 846078
chr1 200259948 rs7527628 T A 846079
Genes possibly regulated by ZNF274[chr1:200259334-200259954]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:200259334-200259954]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results