EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr1:201501808-201502957]
Chromosome characteristics of TCF7L2[chr1:201501808-201502957]
Back to top
Enhancers possibly regulated by TCF7L2[chr1:201501808-201502957]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 201492445 201517481 enh12522
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Lung (PC-9) Bone (Osteoblast) Stomach Muscle (A673) Placenta Colon (HCT116) Uterus Muscle (Myoblast) Pancreas Spleen Neural Stem Cells (H9) Heart
SNP sites on TCF7L2[chr1:201501808-201502957]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 201501840 rs138560611 A G 854828
chr1 201501963 rs34569491 T C 854829
chr1 201501966 rs12725630 T A 854830
chr1 201501967 rs12725631 T C 854831
chr1 201502087 rs548078613 G A 854832
chr1 201502136 rs73082519 G A 854833
chr1 201502262 rs537500109 A G 854834
chr1 201502262 rs577996600 AG A 854835
chr1 201502276 rs144533179 A C 854836
chr1 201502306 rs6660613 T A 854837
chr1 201502327 rs191303937 A T 854838
chr1 201502367 rs148488572 A G 854839
chr1 201502592 rs6672166 A G 854840
chr1 201502809 rs112817991 C T 854841
chr1 201502890 rs374685142 GCAAAACCAGCTACATAATTTA G 854842
chr1 201502890 rs545325226 GCAAAACCAGCTACATAATTTA G 854843
chr1 201502946 rs112430921 T C 854844
Genes possibly regulated by TCF7L2[chr1:201501808-201502957]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr1:201501808-201502957]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results