Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 204004098 204013595 enh67245

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 204006522 rs145769206 C T 872945
chr1 204006538 rs4951291 T C 872946
chr1 204006547 rs11803208 G A 872947
chr1 204006597 rs4951039 G A 872948
chr1 204006607 rs558656176 TCAGGGGAGGCAACGTTGTCTGCCCTCCTCTCCTCC T 872949
chr1 204006663 rs74138920 C A,T 872950
chr1 204006687 rs73067708 G A 872951
chr1 204006881 rs115977591 G C 872952

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results