EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:211910802-211911234]
Chromosome characteristics of ZNF274[chr1:211910802-211911234]
Back to top
Enhancers possibly regulated by ZNF274[chr1:211910802-211911234]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 211903585 211916175 enh908
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Thyroid Breast Blood (Karpas-422) Lung (PC-9) Pancreas Pancreas (Panc1) Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr1:211910802-211911234]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 211910840 rs543728221 G C 918701
chr1 211910904 rs187580824 G A 918702
chr1 211910912 rs113788657 C T 918703
chr1 211911078 rs11119804 T C 918704
chr1 211911195 rs561517569 GGGGGGAGACAGGCCTTAGGGGCCA G 918705
chr1 211911200 rs58845507 G A,T 918706
chr1 211911212 rs535471464 A G 918707
chr1 211911218 rs553895962 C T 918708
chr1 211911219 rs72747036 A G 918709
Genes possibly regulated by ZNF274[chr1:211910802-211911234]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:211910802-211911234]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results