Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212094503 rs115265380 C T 919696
chr1 212094504 rs527842989 A ATGGGACATGAGTAGCAGAGTATAGCCAAGTGAGGACTGGGAGAACT 919697
chr1 212094536 rs141702812 G T 919698
chr1 212094577 rs558601508 A G 919699
chr1 212094669 rs6664087 G A,T 919700
chr1 212094671 rs111274033 G A 919701
chr1 212094700 rs370999181 C A,T 919702
chr1 212095157 rs537882286 C T 919703
chr1 212095163 rs12116748 C T 919704

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results