Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212109825 rs2993541 A G 919886
chr1 212109849 rs149613430 C CCACCA 919887
chr1 212109849 rs372019048 C CCACCA 919888
chr1 212109858 rs187355765 C T 919889
chr1 212109874 rs73091045 G C 919890
chr1 212110005 rs541202973 TTTAGACTTCTCACTACATCTCA T 919891
chr1 212110011 rs17018234 C G 919892
chr1 212110039 rs192619574 T C 919893

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results