EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212285331-212289592]
Chromosome characteristics of ZNF274[chr1:212285331-212289592]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212285331-212289592]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212276365 212288295 enh67261
Bone Marrow (K562) Brain (SK-N-MC) Muscle (A673) Neural Stem Cells (H9) Stomach
chr1 212289525 212302849 enh58214
Bone Marrow (K562) Skin (Keratinocyte) Esophagus Blood (OCI-LY7) Stomach Neural Stem Cells (H9) Heart
SNP sites on ZNF274[chr1:212285331-212289592]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212285458 rs116685677 A G 920425
chr1 212285555 rs3010027 G A,C 920426
chr1 212285584 rs536836338 AAAAC A 920427
chr1 212285747 rs142357150 C A 920428
chr1 212285894 rs574726769 G A 920429
chr1 212286059 rs183067842 A G 920430
chr1 212286291 rs112480453 A G 920431
chr1 212286342 rs549803526 T C 920432
chr1 212286466 rs114478555 G C 920433
chr1 212286475 rs147913850 A C 920434
chr1 212286512 rs113194655 G A 920435
chr1 212286542 rs140280804 T TC 920436
chr1 212286866 rs574874048 G A 920437
chr1 212286899 rs572128376 C T 920438
chr1 212286941 rs141642144 T G 920439
chr1 212287054 rs6690508 A G 920440
chr1 212287099 rs6704044 G C,T 920441
chr1 212287166 rs539451557 A G 920442
chr1 212287180 rs143683736 G A 920443
chr1 212287208 rs79968699 G A 920444
chr1 212287360 rs148036145 G A,C 920445
chr1 212287443 rs188893161 G C 920446
chr1 212287515 rs141715865 A G 920447
chr1 212288002 rs180993540 C T 920448
chr1 212288040 rs138752046 C T 920449
chr1 212288071 rs60864786 A T 920450
chr1 212288141 rs1965956 A C,G 920451
chr1 212288175 rs1965955 G C 920452
chr1 212288188 rs181114093 G A 920453
chr1 212288221 rs112857151 GTT G 920454
chr1 212288339 rs145333368 T TTGTCATGGTGATTGTCAAC 920455
chr1 212288339 rs71137720 T TTGTCATGGTGATTGTCAAC 920456
chr1 212288480 rs114782331 A T 920457
chr1 212288560 rs185870943 T C 920458
chr1 212288631 rs114864218 A G 920459
chr1 212288658 rs190382464 A T 920460
chr1 212288714 rs374154080 C G,T 920461
chr1 212288715 rs368415337 G A 920462
chr1 212288767 rs146182324 C T 920463
chr1 212288790 rs552645637 C T 920464
chr1 212288816 rs187888890 G A 920465
chr1 212288924 rs568070639 C T 920466
chr1 212289037 rs182728378 A C 920467
chr1 212289076 rs560041811 G A 920468
chr1 212289218 rs139048174 T C 920469
chr1 212289306 rs149486511 T G 920470
chr1 212289454 rs562041663 G C 920471
Genes possibly regulated by ZNF274[chr1:212285331-212289592]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:212285331-212289592]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results