Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 223346429 223358855 enh12705
chr1 223356140 223356312 vista5264

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 223355715 rs72743869 A G 975610
chr1 223355818 rs72743871 C T 975611
chr1 223355945 rs147970012 GTAGA G 975612
chr1 223355993 rs187142426 A G 975613
chr1 223356005 rs72743873 A G 975614
chr1 223356008 rs138601138 GA G 975615
chr1 223356052 rs564362636 T G 975616
chr1 223356184 rs76194350 T C 975617
chr1 223356207 rs72743874 T C 975618
chr1 223356227 rs138768941 A AAAAATCATTATTTTTTAATGATTTTT 975619

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results