EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:234816432-234818023]
Chromosome characteristics of ZNF274[chr1:234816432-234818023]
Back to top
Enhancers possibly regulated by ZNF274[chr1:234816432-234818023]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 234809879 234823595 enh12794
Skin (Keratinocyte) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Lung (PC-9) Bone (Osteoblast) Stomach Placenta Adrenal Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on ZNF274[chr1:234816432-234818023]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234816482 rs540359951 A G 1044926
chr1 234816485 rs143458692 TAGGGATGCGGGGCTGGCGGTTGGGAGAC T 1044927
chr1 234816493 rs2439499 C T 1044928
chr1 234816502 rs182420763 C A,T 1044929
chr1 234816503 rs550985663 G A,C,T 1044930
chr1 234816513 rs2439498 C T 1044931
chr1 234816516 rs530470784 G A 1044932
chr1 234816521 rs374160449 C T 1044933
chr1 234816554 rs482329 G A,C 1044934
chr1 234816649 rs187492872 G C 1044935
chr1 234816659 rs146893513 C G,T 1044936
chr1 234816754 rs115182053 G A 1044937
chr1 234816959 rs192863448 C T 1044938
chr1 234817027 rs12046551 C A 1044939
chr1 234817065 rs575104080 G A 1044940
chr1 234817084 rs28411936 C G 1044941
chr1 234817147 rs563012333 A G 1044942
chr1 234817283 rs592197 C G 1044943
chr1 234817305 rs11807455 G A 1044944
chr1 234817329 rs72752209 C T 1044945
chr1 234817355 rs148150218 G A 1044946
chr1 234817411 rs56896656 AC A 1044947
chr1 234817448 rs111274909 G C 1044948
chr1 234817480 rs554490857 T C 1044949
chr1 234817527 rs80315766 C T 1044950
chr1 234817540 rs79435777 C G 1044951
chr1 234817594 rs541830046 G A 1044952
chr1 234817617 rs73108579 T C 1044953
chr1 234817618 rs115260556 G A 1044954
chr1 234817681 rs11811099 C T 1044955
chr1 234817765 rs141879390 C T 1044956
chr1 234817914 rs184102213 G A 1044957
chr1 234818016 rs138711955 A G 1044958
Genes possibly regulated by ZNF274[chr1:234816432-234818023]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:234816432-234818023]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results