EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:21625041-21625439]
Chromosome characteristics of ZNF274[chr10:21625041-21625439]
Back to top
Enhancers possibly regulated by ZNF274[chr10:21625041-21625439]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 21614165 21633695 enh13039
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Esophagus Astrocyte Placenta Colon (HCT116) Uterus Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on ZNF274[chr10:21625041-21625439]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 21625090 rs112220722 T C 1253163
chr10 21625102 rs112691229 C T 1253164
chr10 21625145 rs7091420 G T 1253165
chr10 21625175 rs7092545 C A 1253166
chr10 21625192 rs371204743 G GGGTCTCGCTATGTTGTCCAGGCT 1253167
chr10 21625192 rs71392185 G GGGTCTCGCTATGTTGTCCAGGCT 1253168
chr10 21625217 rs73592504 A G 1253169
chr10 21625256 rs73592505 T G 1253170
chr10 21625317 rs73592506 T C 1253171
chr10 21625331 rs11596761 C T 1253172
chr10 21625368 rs73592507 C G,T 1253173
chr10 21625397 rs73592508 G A,C 1253174
Genes possibly regulated by ZNF274[chr10:21625041-21625439]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:21625041-21625439]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results