Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 22904668 rs143282640 A G 1259622
chr10 22904715 rs117070332 T C 1259623
chr10 22904722 rs75937098 T C 1259624
chr10 22904855 rs555041904 CGACTTCTTGTTCCTGTTTATGCCG C 1259625
chr10 22904903 rs1326339 G A 1259626
chr10 22904946 rs141874086 TGCTGCCCGGCCATTGGGCATCAAA T 1259627
chr10 22905131 rs1778351 G A 1259628
chr10 22905168 rs572331120 G A 1259629
chr10 22905189 rs1778352 G A 1259630
chr10 22905234 rs1778353 C T 1259631

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results