Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 30836165 30850415 enh13109

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 30840346 rs140080441 C T 1306503
chr10 30840354 rs8181394 C T 1306504
chr10 30840373 rs11484277 A AT 1306505
chr10 30840374 rs115030071 A T 1306506
chr10 30840388 rs71525601 A AGGTCTTACTGTGC 1306507
chr10 30840641 rs16931654 G C 1306508
chr10 30840651 rs75531256 T A 1306509
chr10 30840711 rs150988390 G C,T 1306510
chr10 30840779 rs142921006 TTAATAATGTACAATGTATTACATTGTA T 1306511
chr10 30840847 rs115242063 T A 1306512

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results