EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:30840611-30841027]
Chromosome characteristics of ZNF274[chr10:30840611-30841027]
Back to top
Enhancers possibly regulated by ZNF274[chr10:30840611-30841027]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 30836165 30850415 enh13109
Bone Marrow (K562) Liver (HepG2) Large Intestine Esophagus Stomach Muscle (A673) Placenta Uterus Lung (PC-9) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF274[chr10:30840611-30841027]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 30840641 rs16931654 G C 1306508
chr10 30840651 rs75531256 T A 1306509
chr10 30840711 rs150988390 G C,T 1306510
chr10 30840779 rs142921006 TTAATAATGTACAATGTATTACATTGTA T 1306511
chr10 30840847 rs115242063 T A 1306512
chr10 30840945 rs72808100 T C 1306513
chr10 30840958 rs575320941 G T 1306514
chr10 30841001 rs12257084 C T 1306515
Genes possibly regulated by ZNF274[chr10:30840611-30841027]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:30840611-30841027]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results