EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:33401139-33401773]
Chromosome characteristics of ZNF274[chr10:33401139-33401773]
Back to top
Enhancers possibly regulated by ZNF274[chr10:33401139-33401773]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 33393842 33437095 enh1172
Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Blood (OCI-LY7) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on ZNF274[chr10:33401139-33401773]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 33401280 rs137956983 C A 1323522
chr10 33401658 rs60415819 T C 1323523
chr10 33401715 rs201026848 ATTTTTTTTCTATGATATTCAT A 1323524
chr10 33401727 rs60291387 T G 1323525
chr10 33401743 rs201031040 T C 1323526
chr10 33401753 rs117179242 C A 1323527
Genes possibly regulated by ZNF274[chr10:33401139-33401773]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:33401139-33401773]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results