EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:99483216-99484383]
Chromosome characteristics of ZNF274[chr10:99483216-99484383]
Back to top
Enhancers possibly regulated by ZNF274[chr10:99483216-99484383]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99480905 99489116 enh13442
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Bone (Osteoblast) Placenta Uterus Stomach
SNP sites on ZNF274[chr10:99483216-99484383]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99483315 rs181493267 C A,T 1605711
chr10 99483316 rs186918604 G A 1605712
chr10 99483427 rs75595199 G A 1605713
chr10 99483571 rs573627681 G A 1605714
chr10 99483644 rs34840628 G A 1605715
chr10 99483813 rs575198258 A T 1605716
chr10 99483905 rs189575897 C T 1605717
chr10 99484043 rs193263629 C T 1605718
chr10 99484216 rs144053860 C T 1605719
chr10 99484359 rs566706371 AGCTCTATCTCTTATTAGTTGT A 1605720
Genes possibly regulated by ZNF274[chr10:99483216-99484383]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:99483216-99484383]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results