Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99480905 99489116 enh13442

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99484216 rs144053860 C T 1605719
chr10 99484359 rs566706371 AGCTCTATCTCTTATTAGTTGT A 1605720

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results