EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr11:69245437-69246399]
Chromosome characteristics of TCF7L2[chr11:69245437-69246399]
Back to top
Enhancers possibly regulated by TCF7L2[chr11:69245437-69246399]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69240265 69271075 enh14035
Bone Marrow (K562) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Bone (Osteoblast) Lung (A549) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on TCF7L2[chr11:69245437-69246399]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69245453 rs115929209 A G 2073650
chr11 69245462 rs187883364 C T 2073651
chr11 69245542 rs570709185 A C 2073652
chr11 69245550 rs139693479 C A,T 2073653
chr11 69245551 rs77645471 G A 2073654
chr11 69245709 rs555234770 G A 2073655
chr11 69245783 rs565093651 C T 2073656
chr11 69245812 rs7927237 A C 2073657
chr11 69245813 rs544947824 T C 2073658
chr11 69245941 rs534494777 GTTTTTAAGTTCATTATTATTATTTTT G 2073659
chr11 69246001 rs188873213 T C 2073660
chr11 69246077 rs2154681 T C 2073661
chr11 69246090 rs147907386 C A 2073662
chr11 69246120 rs536987264 C G 2073663
chr11 69246361 rs13377575 T C 2073664
chr11 69246369 rs116540175 A C 2073665
Genes possibly regulated by TCF7L2[chr11:69245437-69246399]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr11:69245437-69246399]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results