Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 72454767 rs56251316 G A 2095698
chr11 72454825 rs55816648 T A 2095699
chr11 72454977 rs565127390 C T 2095700
chr11 72455034 rs2886367 C T 2095701
chr11 72455049 rs79356119 G T 2095702
chr11 72455152 rs5008485 C A,T 2095703
chr11 72455185 rs575786831 ATGTCACCATCTGTGACTGTGTG A 2095704
chr11 72455207 rs2886366 G C 2095705

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results