EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr11:74379791-74380561]
Chromosome characteristics of ZNF143[chr11:74379791-74380561]
Back to top
Enhancers possibly regulated by ZNF143[chr11:74379791-74380561]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 74380525 74407468 enh14087
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Ovary Esophagus Astrocyte Lung (PC-9) Bone (Osteoblast) Stomach Muscle (A673) Placenta Breast Uterus Muscle (Myoblast) Pancreas Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on ZNF143[chr11:74379791-74380561]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 74379809 rs397716648 G GT 2106098
chr11 74379809 rs56330626 G GT 2106099
chr11 74379872 rs557747297 G A 2106100
chr11 74379887 rs117526209 C T 2106101
chr11 74379907 rs377194637 G C 2106102
chr11 74380112 rs150257742 A C 2106103
chr11 74380164 rs199658338 CGTT C 2106104
chr11 74380310 rs184797687 A T 2106105
chr11 74380510 rs534804293 A G 2106106
chr11 74380515 rs113959856 A G 2106107
chr11 74380534 rs376138728 A G 2106108
chr11 74380553 rs150142341 C CCCAAGGA,CCCAGGGAATTGCTG,CCCAGGGAATTGCTGCAGGCGCAGGCCCAGGA 2106109
Genes possibly regulated by ZNF143[chr11:74379791-74380561]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr11:74379791-74380561]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results