EnhancerDB
  1. Home
  2. TFBS
  3. TEF1[chr11:76325019-76325709]
Chromosome characteristics of TEF1[chr11:76325019-76325709]
Back to top
Enhancers possibly regulated by TEF1[chr11:76325019-76325709]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 76307544 76351195 enh1910
Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Bone (Osteoblast) Blood (OCI-LY7) Stomach Muscle (A673) Placenta Uterus Blood (Karpas-422) Pancreas Spleen Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on TEF1[chr11:76325019-76325709]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 76325022 rs59656935 G A 2117961
chr11 76325044 rs527547935 C T 2117962
chr11 76325110 rs58547072 A G 2117963
chr11 76325282 rs17135045 G A 2117964
chr11 76325679 rs552895745 G GGGAGCCAGGGGGCTGTTAGTC 2117965
chr11 76325694 rs7101546 G A 2117966
chr11 76325708 rs7121332 T C 2117967
Genes possibly regulated by TEF1[chr11:76325019-76325709]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TEF1[chr11:76325019-76325709]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results