Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 109894065 109906915 enh14983
chr12 109900309 109900503 vista14850
chr12 109900993 109901418 vista14851

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 109899776 rs66490142 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892669
chr12 109899776 rs71443859 CGCTGTGCCCTGTTCCACTCCTAACAAT C 2892670
chr12 109899831 rs11066718 G C 2892671
chr12 109899899 rs72647795 G C 2892672
chr12 109900077 rs68032303 C T 2892673
chr12 109900150 rs138116819 C T 2892674
chr12 109900243 rs113579224 C T 2892675
chr12 109900538 rs56406401 T C 2892676
chr12 109900596 rs4766473 C T 2892677
chr12 109900765 rs1990715 T C 2892678
chr12 109900956 rs558420570 C T 2892679
chr12 109900977 rs10160889 G A 2892680

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results