EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:116930680-116930964]
Chromosome characteristics of ZNF274[chr12:116930680-116930964]
Back to top
Enhancers possibly regulated by ZNF274[chr12:116930680-116930964]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 116926365 116948935 enh43835
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Lung (PC-9) Esophagus Bone (Osteoblast) Stomach Colon (HCT116) Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
chr12 116930750 116930937 vista15032
VISTA
SNP sites on ZNF274[chr12:116930680-116930964]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 116930681 rs17581502 T C 2928081
chr12 116930812 rs59169088 ACATGAGTCAGCAGAAGTCATCAGTCAGTAGAAAC A 2928082
chr12 116930812 rs67047256 ACATGAGTCAGCAGAAGTCATCAGTCAGTAGAAAC A 2928083
chr12 116930844 rs566181474 A C 2928084
chr12 116930878 rs184972268 A C 2928085
chr12 116930900 rs188909884 T C 2928086
Genes possibly regulated by ZNF274[chr12:116930680-116930964]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr12:116930680-116930964]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results