EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:52824356-52825285]
Chromosome characteristics of ZNF274[chr14:52824356-52825285]
Back to top
Enhancers possibly regulated by ZNF274[chr14:52824356-52825285]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 52813105 52825015 enh30879
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Ovary Astrocyte Lung Lung (PC-9) Muscle (Myoblast) Spleen Uterus Blood (T-cell) Stomach
SNP sites on ZNF274[chr14:52824356-52825285]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 52824473 rs201970362 C CA 3542352
chr14 52824538 rs551798332 ATTAT A 3542353
chr14 52824601 rs199685831 ATATATACACATAAATTATATG A 3542354
chr14 52824601 rs58887037 ATATATACACATAAATTATATG A 3542355
chr14 52824612 rs538818094 T C 3542356
chr14 52824616 rs558836379 T G 3542357
chr14 52824688 rs183574351 A T 3542358
chr14 52824689 rs145311221 C T 3542359
chr14 52824695 rs151006209 T G 3542360
chr14 52824774 rs540701150 T C 3542361
chr14 52824864 rs202074901 A ATG 3542362
chr14 52824913 rs553947927 C A 3542363
chr14 52825270 rs4901273 G A 3542364
Genes possibly regulated by ZNF274[chr14:52824356-52825285]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:52824356-52825285]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results