EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:65804561-65806156]
Chromosome characteristics of ZNF274[chr14:65804561-65806156]
Back to top
Enhancers possibly regulated by ZNF274[chr14:65804561-65806156]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65806005 65830965 enh3291
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Epithelial (MCF-7)
chr14 65794325 65805219 enh3290
Prostate (PC-3) Brain (SK-N-MC) Large Intestine Ovary Esophagus Astrocyte Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr14:65804561-65806156]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65804664 rs181331883 C A,T 3611701
chr14 65804665 rs12878872 G A 3611702
chr14 65804682 rs186196363 G A 3611703
chr14 65804808 rs112359450 C T 3611704
chr14 65804839 rs529814659 T TA 3611705
chr14 65804858 rs191047944 T C 3611706
chr14 65805101 rs138369092 G A 3611707
chr14 65805410 rs747541 C A 3611708
chr14 65805525 rs747540 A G 3611709
chr14 65805652 rs115478488 A G 3611710
chr14 65805709 rs1954052 T A,C 3611711
chr14 65805772 rs187839840 A G 3611712
chr14 65805837 rs142840839 C T 3611713
chr14 65805838 rs191035900 G A 3611714
chr14 65805950 rs144250522 A G 3611715
chr14 65806017 rs148710830 C T 3611716
chr14 65806019 rs558780943 C T 3611717
chr14 65806115 rs17102614 A G 3611718
chr14 65806141 rs78164824 T G 3611719
chr14 65806145 rs574333126 C CTATTGCTTATACTATAAGCAATTAG 3611720
Genes possibly regulated by ZNF274[chr14:65804561-65806156]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:65804561-65806156]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 65801841 65801862 - hsa-miR-4708-3p MIMAT0019810 65801901 0.0 0.0 2660 407
Expression level of miRNAs
Back to top