EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr14:74207794-74208463]
Chromosome characteristics of ZBTB33[chr14:74207794-74208463]
Back to top
Enhancers possibly regulated by ZBTB33[chr14:74207794-74208463]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 74205176 74254969 enh3322
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr14 74207610 74207866 vista18416
VISTA
chr14 74208106 74208498 vista18417
VISTA
SNP sites on ZBTB33[chr14:74207794-74208463]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74207888 rs146631266 CAGA C 3656942
chr14 74207888 rs373095936 CAGA C 3656943
chr14 74207978 rs575985950 G C 3656944
chr14 74208118 rs561169845 T C 3656945
chr14 74208148 rs192932391 G A 3656946
chr14 74208252 rs371291071 C T 3656947
chr14 74208341 rs59939420 C A 3656948
chr14 74208345 rs533217053 CGCTCCTCTGCAGGCTTCCGCA C 3656949
Genes possibly regulated by ZBTB33[chr14:74207794-74208463]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr14:74207794-74208463]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results