Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74208341 rs59939420 C A 3656948
chr14 74208345 rs533217053 CGCTCCTCTGCAGGCTTCCGCA C 3656949
chr14 74208571 rs75911058 T C 3656950
chr14 74208662 rs17782146 C G 3656951
chr14 74208670 rs80160896 C T 3656952

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results