EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:95963971-95964407]
Chromosome characteristics of ZZZ3[chr14:95963971-95964407]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:95963971-95964407]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 95943889 95977005 enh3416
Liver Astrocyte Blood (Karpas-422) Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Breast Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on ZZZ3[chr14:95963971-95964407]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95964022 rs1885424 C T 3756648
chr14 95964075 rs181511138 T C 3756649
chr14 95964082 rs139139133 AAATGAGCATGACTGCGTTCC A 3756650
chr14 95964082 rs374057988 AAATGAGCATGACTGCGTTCC A 3756651
chr14 95964131 rs190072683 G C,T 3756652
chr14 95964196 rs72692796 A T 3756653
chr14 95964366 rs537558987 T TAAA,TAAAA 3756654
chr14 95964387 rs147598699 AAGT A 3756655
chr14 95964387 rs369888092 AAGT A 3756656
Genes possibly regulated by ZZZ3[chr14:95963971-95964407]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:95963971-95964407]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results