EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr15:39492125-39492596]
Chromosome characteristics of ZNF143[chr15:39492125-39492596]
Back to top
Enhancers possibly regulated by ZNF143[chr15:39492125-39492596]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 39472205 39509375 enh16053
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Lung (PC-9) Placenta Colon (HCT116) Uterus Thyroid Muscle (Myoblast) Pancreas Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF143[chr15:39492125-39492596]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39492218 rs551124066 AC A 3903355
chr15 39492234 rs60344422 C T 3903356
chr15 39492267 rs10520122 T C 3903357
chr15 39492309 rs16968383 A G 3903358
chr15 39492382 rs74398019 T C 3903359
chr15 39492426 rs56244329 C T 3903360
chr15 39492451 rs539086468 GGACCCCTCACTCTGCTAACACTGTGGA G 3903361
chr15 39492558 rs61062942 TAG T 3903362
chr15 39492558 rs796342929 TAG T 3903363
Genes possibly regulated by ZNF143[chr15:39492125-39492596]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr15:39492125-39492596]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results