Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39492218 rs551124066 AC A 3903355
chr15 39492234 rs60344422 C T 3903356
chr15 39492267 rs10520122 T C 3903357
chr15 39492309 rs16968383 A G 3903358
chr15 39492382 rs74398019 T C 3903359
chr15 39492426 rs56244329 C T 3903360
chr15 39492451 rs539086468 GGACCCCTCACTCTGCTAACACTGTGGA G 3903361
chr15 39492558 rs61062942 TAG T 3903362
chr15 39492558 rs796342929 TAG T 3903363

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results