EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:56341186-56341677]
Chromosome characteristics of ZNF274[chr15:56341186-56341677]
Back to top
Enhancers possibly regulated by ZNF274[chr15:56341186-56341677]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 56329348 56341835 enh16155
Liver Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Skin (Keratinocyte) Lung (A549) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673)
chr15 56341448 56341541 vista20065
VISTA
SNP sites on ZNF274[chr15:56341186-56341677]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 56341211 rs145157801 T G 3970399
chr15 56341312 rs73424841 G A 3970400
chr15 56341408 rs565987010 G A 3970401
chr15 56341485 rs78791728 T C 3970402
chr15 56341529 rs182826501 A C,T 3970403
chr15 56341554 rs77969000 G A 3970404
chr15 56341556 rs537643613 A ATGCGTGTGTGTGTGAGTGATCTCTGTG 3970405
chr15 56341587 rs61570264 A ATG 3970406
chr15 56341587 rs749233313 A ATG 3970407
chr15 56341587 rs796259808 A ATG 3970408
chr15 56341638 rs55810058 A C 3970409
chr15 56341654 rs552932735 T C 3970410
Genes possibly regulated by ZNF274[chr15:56341186-56341677]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:56341186-56341677]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results