Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 58815743 rs74981309 G A 3987952
chr15 58815745 rs71116570 G GT 3987953
chr15 58815762 rs16940442 A G 3987954
chr15 58815772 rs77151170 T G 3987955
chr15 58815807 rs397702969 A AT 3987956
chr15 58815807 rs59557225 A AT 3987957
chr15 58815928 rs115913557 A G 3987958
chr15 58816004 rs80246805 T C 3987959
chr15 58816012 rs537256261 C T 3987960
chr15 58816045 rs541999307 GATCGCTTGAGCCCAAGAGGTCAAGGCTGCAGTGAGC G 3987961
chr15 58816049 rs147712537 G A 3987962
chr15 58816081 rs578018459 C G 3987963
chr15 58816123 rs73424689 T C 3987964
chr15 58816261 rs74019120 T C 3987965
chr15 58816387 rs188899507 A G 3987966
chr15 58816478 rs74464581 C A 3987967
chr15 58816554 rs143096565 G T 3987968

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results