EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:99981066-99981736]
Chromosome characteristics of ZNF274[chr15:99981066-99981736]
Back to top
Enhancers possibly regulated by ZNF274[chr15:99981066-99981736]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99971645 99998102 enh16467
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr15:99981066-99981736]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99981069 rs540767472 A AGGGAGAATCTCATCTACCACCTACTGGGTGGATAACTAT 4225710
chr15 99981213 rs145253346 G A 4225711
chr15 99981269 rs4965490 T C,G 4225712
chr15 99981333 rs576440337 C T 4225713
chr15 99981385 rs137908011 T C 4225714
chr15 99981440 rs186237040 A G 4225715
chr15 99981485 rs188163142 A C 4225716
chr15 99981582 rs186447882 G A 4225717
chr15 99981588 rs548366871 C G 4225718
chr15 99981615 rs28528723 G A 4225719
Genes possibly regulated by ZNF274[chr15:99981066-99981736]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:99981066-99981736]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results