EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:14495036-14496365]
Chromosome characteristics of ZNF143[chr16:14495036-14496365]
Back to top
Enhancers possibly regulated by ZNF143[chr16:14495036-14496365]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 14436207 14505799 enh3905
Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on ZNF143[chr16:14495036-14496365]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 14495074 rs139922778 G C 4343760
chr16 14495194 rs185805938 G A 4343761
chr16 14495670 rs186034307 G A 4343762
chr16 14495700 rs562582496 C T 4343763
chr16 14495706 rs143303821 A AGCCAAGTCCAGCACCACAGCACAAATCCT 4343764
chr16 14495706 rs369564207 A AGCCAAGTCCAGCACCACAGCACAAATCCT 4343765
chr16 14495747 rs7194369 G A 4343766
chr16 14495847 rs7200404 C T 4343767
chr16 14495872 rs140375224 C T 4343768
chr16 14495983 rs142670477 C T 4343769
chr16 14495996 rs534319883 A AT 4343770
chr16 14496016 rs111546011 C T 4343771
chr16 14496204 rs7201207 C T 4343772
chr16 14496213 rs74009167 C T 4343773
chr16 14496254 rs560364107 G A 4343774
chr16 14496282 rs542875927 C A 4343775
Genes possibly regulated by ZNF143[chr16:14495036-14496365]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:14495036-14496365]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results