EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:27376767-27379412]
Chromosome characteristics of ZNF274[chr16:27376767-27379412]
Back to top
Enhancers possibly regulated by ZNF274[chr16:27376767-27379412]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27372645 27392475 enh16615
Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr16:27376767-27379412]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27376898 rs3024698 T A,C 4395387
chr16 27376910 rs3024685 T C 4395388
chr16 27376928 rs535643067 C T 4395389
chr16 27376991 rs371048257 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395390
chr16 27376991 rs536606820 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395391
chr16 27377010 rs35146330 T TC 4395392
chr16 27377010 rs75614111 T TC 4395393
chr16 27377042 rs150499669 G A 4395394
chr16 27377102 rs139465884 A G 4395395
chr16 27377111 rs192892155 T C 4395396
chr16 27377163 rs61472122 CTGA C 4395397
chr16 27377163 rs72064218 CTGA C 4395398
chr16 27377500 rs145204611 G A 4395399
chr16 27377571 rs147618744 A G 4395400
chr16 27377712 rs373108611 C G,T 4395401
chr16 27377736 rs181137762 G T 4395402
chr16 27377792 rs142348681 A C 4395403
chr16 27377792 rs535097291 A AAC 4395404
chr16 27377794 rs202020050 A AC 4395405
chr16 27377795 rs57085413 A C 4395406
chr16 27378053 rs12102586 C T 4395407
chr16 27378170 rs4787955 C T 4395408
chr16 27378191 rs187174665 G C 4395409
chr16 27378205 rs374584339 C T 4395410
chr16 27378209 rs192100890 C A,T 4395411
chr16 27378212 rs529748935 C T 4395412
chr16 27378240 rs115702526 C T 4395413
chr16 27378249 rs4787956 A C,G 4395414
chr16 27378424 rs114608119 C T 4395415
chr16 27378433 rs112413655 C G 4395416
chr16 27378461 rs140467433 A G 4395417
chr16 27378494 rs144942524 GC G 4395418
chr16 27378560 rs573933707 G C 4395419
chr16 27378734 rs541263608 AGG A 4395420
chr16 27378734 rs557948291 A AG 4395421
chr16 27378736 rs576153846 G C,T 4395422
chr16 27378764 rs577766110 AT A 4395423
chr16 27378764 rs5816434 AT A 4395424
chr16 27378936 rs572236018 C A 4395425
chr16 27379068 rs145885444 C T 4395426
chr16 27379313 rs141451294 G T 4395427
Genes possibly regulated by ZNF274[chr16:27376767-27379412]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:27376767-27379412]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results