EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85371948-85373703]
Chromosome characteristics of TCF7L2[chr16:85371948-85373703]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85371948-85373703]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85333005 85372015 enh16866
Bone Marrow (K562) Brain (SK-N-MC) Liver Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on TCF7L2[chr16:85371948-85373703]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85371972 rs573750690 C G 4621086
chr16 85372007 rs2875951 A C 4621087
chr16 85372023 rs58068094 C T 4621088
chr16 85372039 rs190583243 G A 4621089
chr16 85372040 rs182575131 C T 4621090
chr16 85372082 rs368645364 A C,G 4621091
chr16 85372126 rs187171864 G A 4621092
chr16 85372154 rs56245946 C T 4621093
chr16 85372257 rs118116068 C T 4621094
chr16 85372360 rs75661820 A G 4621095
chr16 85372374 rs536433182 G GCCCAGAGAGGTTTAATCACTTCC 4621096
chr16 85372415 rs149954442 G A,T 4621097
chr16 85372434 rs145139038 G A 4621098
chr16 85372546 rs531825744 A G 4621099
chr16 85372581 rs551057597 C G,T 4621100
chr16 85372591 rs190210532 G A 4621101
chr16 85372689 rs141115096 C G 4621102
chr16 85372723 rs115524779 G A 4621103
chr16 85372765 rs369038371 C T 4621104
chr16 85372787 rs538865874 A G 4621105
chr16 85372796 rs145616455 C T 4621106
chr16 85372797 rs4783170 A G,T 4621107
chr16 85372859 rs75289636 C T 4621108
chr16 85372993 rs74737774 G A 4621109
chr16 85372994 rs57764278 C T 4621110
chr16 85373017 rs75723661 G A 4621111
chr16 85373018 rs575207802 ACT A 4621112
chr16 85373039 rs58631551 C T 4621113
chr16 85373129 rs571719455 G C,T 4621114
chr16 85373168 rs146551126 T C 4621115
chr16 85373379 rs536280069 C T 4621116
chr16 85373387 rs74982182 T C 4621117
chr16 85373420 rs185084043 G A 4621118
chr16 85373534 rs72809701 C A,G,T 4621119
Genes possibly regulated by TCF7L2[chr16:85371948-85373703]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85371948-85373703]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results