EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr16:85425298-85425588]
Chromosome characteristics of ZBTB33[chr16:85425298-85425588]
Back to top
Enhancers possibly regulated by ZBTB33[chr16:85425298-85425588]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85422125 85439595 enh4173
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Stomach Epithelial (MCF-7) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on ZBTB33[chr16:85425298-85425588]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85425361 rs193160681 G A 4622129
chr16 85425370 rs566373236 AGGTCACTGGAGTAGATGCTTGTGG A 4622130
chr16 85425400 rs560404777 C T 4622131
chr16 85425425 rs369734045 C G,T 4622132
chr16 85425441 rs115915838 T C 4622133
chr16 85425496 rs185021033 G A 4622134
Genes possibly regulated by ZBTB33[chr16:85425298-85425588]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr16:85425298-85425588]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results